Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AcpP pet29a C-terminal His Tag
(Plasmid #75016)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75016 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein expression, grow in BL21s at 37 degrees until an OD of 0.8 is reached (approximately 3-4 hours), induce with 0.5 mM IPTG and grow at 16 degrees for 16 hours.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AcpP
  • Alt name
    Acyl carrier protein from E. coli fatty acid synthase
  • Species
    E. coli
  • Insert Size (bp)
    238
  • GenBank ID
    944805 NC_000913.3
  • Entrez Gene
    acpP (a.k.a. b1094, ECK1080, JW1080)
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AcpP pet29a C-terminal His Tag was a gift from Michael Burkart (Addgene plasmid # 75016 ; http://n2t.net/addgene:75016 ; RRID:Addgene_75016)
  • For your References section:

    Mechanism-based protein cross-linking probes to investigate carrier protein-mediated biosynthesis. Worthington AS, Rivera H, Torpey JW, Alexander MD, Burkart MD. ACS Chem Biol. 2006 Dec 20;1(11):687-91. 10.1021/cb6003965 PubMed 17184132