pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
(Plasmid
#75295)
-
PurposeAn AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene Plasmid #50465
-
Backbone manufacturerBryan Roth
- Backbone size w/o insert (bp) 4554
- Total vector size (bp) 6854
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP-2A-mKv1.2
-
Alt nameeGFP
-
Alt namemurine potassium channel
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)2300
-
Entrez GeneKcna2 (a.k.a. Akr6a4, Gm10672, Kca1-2, Kv1.2, Mk-2)
- Promoter human SYN1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer hSYN1 F417 actcagcgctgcctcagtct
- 3′ sequencing primer WPRE_R1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2 was a gift from Brandon Harvey (Addgene plasmid # 75295 ; http://n2t.net/addgene:75295 ; RRID:Addgene_75295)