Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
(Plasmid #75295)


Item Catalog # Description Quantity Price (USD)
Plasmid 75295 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    Addgene Plasmid #50465
  • Backbone manufacturer
    Bryan Roth
  • Backbone size w/o insert (bp) 4554
  • Total vector size (bp) 6854
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    murine potassium channel
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
  • Entrez Gene
    Kcna2 (a.k.a. Akr6a4, Gm10672, Kca1-2, Kv1.2, Mk-2)
  • Promoter human SYN1

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 actcagcgctgcctcagtct
  • 3′ sequencing primer WPRE_R1
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2 was a gift from Brandon Harvey (Addgene plasmid # 75295 ; ; RRID:Addgene_75295)