pCMV-lyso-pHoenix
(Plasmid #70112)

• Purpose: Expression of lyso-pHoenix in mammalian cells for optogenetic acidification of lysosomes
• Depositing Lab: Christian Rosenmund
• Publication: Rost et al Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	70112	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pCMV
  (Search Vector Database)
• Backbone size w/o insert (bp): 3878
• Total vector size (bp): 7157
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lyso-pHoenix
• Alt name: CD63-pHluorin-Arch3-mKate2-betaHK
• Species: M. musculus (mouse), R. norvegicus (rat); Halorubrum sodomense, Entacmaea quadricolor, Aequorea victoria
• Insert Size (bp): 3492
• GenBank ID: 12512; KT880225
• Entrez Gene: Cd63 (a.k.a. C75951, ME491, Tsp, Tspan30)
• Promoter: CMV
• Tags / Fusion Proteins:
  • pHluorin
  • Arch3
  • mKate2
  • H+/K+ ATPase beta-subunit
  • HA-Tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TTGTGAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Arch3: Addgene Plasmid #22222; mKate2: Evrogen
• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry
• Articles Citing this Plasmid:
  • 2 References