-
Purposelentiviral expression of pHoenix (Synaptophysin-pHluorin-Arch3-mKate2) driven by human Synapsin I promoter for optogenetic acidification of synaptic vesicles
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 70111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 8400
- Total vector size (bp) 11892
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)XL10-gold
-
Growth instructionsResearchers should avoid repetitive freeze-thaw cycles when handling the DNA, as we found that this can lead to DNA degradation. Recommended growth strains are XL10gold and Stbl3.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepHoenix
-
Alt nameSynaphtophysin-pHluorin-Arch3-mKate2-betaHK
-
SpeciesR. norvegicus (rat); Halorubrum sodomense, Entacmaea quadricolor, Aequorea victoria
-
Insert Size (bp)3492
-
GenBank ID24804; KT880224
-
Entrez GeneSyp (a.k.a. Syp1)
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- pHluorin
- Arch3
- mKate2
- H+/K+ ATPase beta-subunit
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CGCTGCCTCAGTCTGCGGTGG
- 3′ sequencing primer AGGAGCAACATAGTTAAGAATACC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bySynaptophsin-2xpHluorin: Stephen Heinemann lab, now Addgene plasmid #37004; Arch3: Addgene Plasmid #22222; mKate2: Evrogen
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Synapsin-pHoenix-WPRE was a gift from Christian Rosenmund (Addgene plasmid # 70111 ; http://n2t.net/addgene:70111 ; RRID:Addgene_70111) -
For your References section:
Optogenetic acidification of synaptic vesicles and lysosomes. Rost BR, Schneider F, Grauel MK, Wozny C, G Bentz C, Blessing A, Rosenmund T, Jentsch TJ, Schmitz D, Hegemann P, Rosenmund C. Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161. 10.1038/nn.4161 PubMed 26551543