pCMV-dCas9-mD3A
(Plasmid
#78257)
-
PurposeExpresses dead Cas9 (dCas9) fused to inactive DNMT3A catalytic domain (CD) under the control of the CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 14357
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNMT3A CD aa 598-912
-
SpeciesH. sapiens (human)
-
Insert Size (bp)948
-
MutationE756A
-
GenBank IDAF480163
-
Entrez GeneDNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
- Promoter pCMV
-
Tag
/ Fusion Protein
- Flag epitope tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ctgcagccttcaagtacttcgacacc
- 3′ sequencing primer tacaaaggcattaaagcagcgta (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-dCas9-mD3A was a gift from Grant Challen (Addgene plasmid # 78257 ; http://n2t.net/addgene:78257 ; RRID:Addgene_78257) -
For your References section:
Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. McDonald JI, Celik H, Rois LE, Fishberger G, Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA. Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067. 10.1242/bio.019067 PubMed 27170255