This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78624)


Item Catalog # Description Quantity Price (USD)
Plasmid 78624 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA(MS2)_Prnp_SAM1 was a gift from Walker Jackson (Addgene plasmid # 78624 ; ; RRID:Addgene_78624)
  • For your References section:

    Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. Kaczmarczyk L, Mende Y, Zevnik B, Jackson WS. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. PONE-D-16-11813 [pii] PubMed 27128441