Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMAL-his-LbCpf1-EC
(Plasmid #79008)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79008 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMAL-c5X
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    LbCpf1
  • Species
    Synthetic
  • Insert Size (bp)
    4000
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • 6xHis (N terminal on backbone)
    • NLS (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008 ; http://n2t.net/addgene:79008 ; RRID:Addgene_79008)
  • For your References section:

    Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Kim D, Kim J, Hur JK, Been KW, Yoon SH, Kim JS. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3609. 10.1038/nbt.3609 PubMed 27272384