-
PurposeBacterial expression - MBP-his tagged LbCpf1 (E.coli codon optimized)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMAL-c5X
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLbCpf1
-
Alt nameLbCas12a
-
SpeciesSynthetic
-
Insert Size (bp)4000
- Promoter tac promoter
-
Tag
/ Fusion Protein
- MBP-6xHis-NLS (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008 ; http://n2t.net/addgene:79008 ; RRID:Addgene_79008) -
For your References section:
Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Kim D, Kim J, Hur JK, Been KW, Yoon SH, Kim JS. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3609. 10.1038/nbt.3609 PubMed 27272384