This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

35S-sfGFP-nosT
(Plasmid #80129)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80129 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Backbone manufacturer
    Clonech
  • Backbone size (bp) 2686
  • Vector type
    Plant Expression
  • Promoter CaMV35S
  • Tag / Fusion Protein
    • sfGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGATCCATGGTGAGCAAGGGCGAGGAGCTG
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCATGCCGAGAGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    35S-sfGFP-nosT was a gift from Yutaka Kodama (Addgene plasmid # 80129 ; http://n2t.net/addgene:80129 ; RRID:Addgene_80129)
  • For your References section:

    In planta comparative analysis of improved green fluorescent proteins with reference to fluorescence intensity and bimolecular fluorescence complementation ability. Fujii Y, Kodama Y. Plant Biotech. 2015; 32(1): 81-87. 10.5511/plantbiotechnology.15.0120a