-
PurposeAllows for expression of an sgRNA in Toxoplasma gondii and confers resistance to pyrimethamine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-Universal
- Backbone size w/o insert (bp) 8380
- Total vector size (bp) 6284
-
Modifications to backboneReplaced Cas9 with DHFR-TSc3
-
Vector typeCRISPR
-
Selectable markersDHFR-TSc3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)dam-/dcm- competent E coli (NEB Catalog# C2925)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDHFR-TSc3
-
SpeciesToxoplasma gondii
-
Insert Size (bp)3057
- Promoter DHFR-TS 5' UTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer ctagcatgtcattcgattttcacc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 80329 ; http://n2t.net/addgene:80329 ; RRID:Addgene_80329) -
For your References section:
A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426