This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBAD-smURFP-RBS-HO-1
(Plasmid #80341)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80341 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD
  • Backbone manufacturer
    Life Technlogies
  • Backbone size w/o insert (bp) 3996
  • Total vector size (bp) 5163
  • Modifications to backbone
    Contains Ribosomal Binding Site for expression of both smURFP and HO-1.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For smURFP and HO-1 expression, arabinose is required.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    smURFP
  • Alt name
    small Ultra-Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    423
  • GenBank ID
    KX449134
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6 Histidine Tag (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer Unnecessary
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HO-1
  • Alt name
    Heme Oxygenase-1
  • Species
    Synechocystis
  • Insert Size (bp)
    723
  • Promoter pBAD

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GGCTATGTCCGAATTCCATCATC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-smURFP-RBS-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80341 ; http://n2t.net/addgene:80341 ; RRID:Addgene_80341)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328