-
PurposeExpresses Tandem Dimer smURFP and Heme Oxygenase-1 in mammalian cells.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 6845
- Total vector size (bp) 7715
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTandem Dimer smURFP
-
Alt nameTandem Dimer small Ultra-Red Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)870
-
GenBank IDKX449135
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGCGTACAAGGGTACCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHO-1
-
Alt nameHeme Oxygenase-1
-
SpeciesSynechocystis
-
Insert Size (bp)723
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer gtggctgcttatggtgacaatc
- 3′ sequencing primer CCTCGACTGTGCCTTCTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAll constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-TDsmURFP-IRES-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80346 ; http://n2t.net/addgene:80346 ; RRID:Addgene_80346) -
For your References section:
A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328