This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80406)


Item Catalog # Description Quantity Price (USD)
Plasmid 80406 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5183
  • Total vector size (bp) 7235
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGGGGCTGTTTGATCGAGGTG
  • 3′ sequencing primer AAACGGGCCCTCTAGgtgacataactaattacatgactcgaG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Stargazin-GFP-LOVpep was a gift from Michael Glotzer (Addgene plasmid # 80406)
  • For your References section:

    Local RhoA activation induces cytokinetic furrows independent of spindle position and cell cycle stage. Wagner E, Glotzer M. J Cell Biol. 2016 Jun 20;213(6):641-9. doi: 10.1083/jcb.201603025. Epub 2016 Jun 13. 10.1083/jcb.201603025 PubMed 27298323