Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PR_GEF (2XPDZ-mCherry-Larg (DH)
(Plasmid #80407)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80407 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 3976
  • Total vector size (bp) 6106
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2XPDZ_mCherry_LARG DH (aa 766-997)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2130
  • Mutation
    DH domain only (aa 766-997)
  • GenBank ID
    NM_015313.2
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GGTTTAGTGAACCGTCAGATCCGCTAGCGC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PR_GEF (2XPDZ-mCherry-Larg (DH) was a gift from Michael Glotzer (Addgene plasmid # 80407)
  • For your References section:

    Local RhoA activation induces cytokinetic furrows independent of spindle position and cell cycle stage. Wagner E, Glotzer M. J Cell Biol. 2016 Jun 20;213(6):641-9. doi: 10.1083/jcb.201603025. Epub 2016 Jun 13. 10.1083/jcb.201603025 PubMed 27298323