-
PurposeRecruitable mCherry tagged RhoA GEF LARG (DH domain). Expresses in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 80407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 3976
- Total vector size (bp) 6106
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2XPDZ_mCherry_LARG DH (aa 766-997)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2130
-
MutationDH domain only (aa 766-997)
-
GenBank IDNM_015313.2
-
Entrez GeneARHGEF12 (a.k.a. LARG, PRO2792)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GGTTTAGTGAACCGTCAGATCCGCTAGCGC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PR_GEF (2XPDZ-mCherry-Larg (DH) was a gift from Michael Glotzer (Addgene plasmid # 80407 ; http://n2t.net/addgene:80407 ; RRID:Addgene_80407) -
For your References section:
Local RhoA activation induces cytokinetic furrows independent of spindle position and cell cycle stage. Wagner E, Glotzer M. J Cell Biol. 2016 Jun 20;213(6):641-9. doi: 10.1083/jcb.201603025. Epub 2016 Jun 13. 10.1083/jcb.201603025 PubMed 27298323