Skip to main content
Addgene

TR-GFP-3'UTR-HP
(Plasmid #80596)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80596 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TR-GFP
  • Backbone size w/o insert (bp) 5927
  • Total vector size (bp) 5957
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Csy4 hairpin
  • Species
    Pseudomonas aeruginosa
  • Insert Size (bp)
    30
  • Promoter CBA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer cctgagcaaagaccccaacgagaagcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TR-GFP-3'UTR-HP was a gift from Aravind Asokan (Addgene plasmid # 80596)
  • For your References section:

    Controlling mRNA stability and translation with the CRISPR endoribonuclease Csy4. Borchardt EK, Vandoros LA, Huang M, Lackey PE, Marzluff WF, Asokan A. RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9. 10.1261/rna.051227.115 PubMed 26354771