Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80602)


Item Catalog # Description Quantity Price (USD)
Plasmid 80602 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV ITR backbone
  • Backbone size w/o insert (bp) 5077
  • Total vector size (bp) 5641
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    Pseudomonas aeruginosa
  • Insert Size (bp)
  • Mutation
    His29 mutated to Ala
  • Promoter CBA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer caaatctgtgcggagccgaaatctgggagg
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TR-Csy4-H29A was a gift from Aravind Asokan (Addgene plasmid # 80602 ; ; RRID:Addgene_80602)
  • For your References section:

    Controlling mRNA stability and translation with the CRISPR endoribonuclease Csy4. Borchardt EK, Vandoros LA, Huang M, Lackey PE, Marzluff WF, Asokan A. RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9. 10.1261/rna.051227.115 PubMed 26354771