This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FCK-Chronos-GFP
(Plasmid #80902)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80902 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCK (1.3)GW
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10947
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3).
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Chronos-GFP
  • Alt name
    Stigeoclonium helveticum channelrhodopsin-GFP
  • Alt name
    ChR90-GFP
  • Species
    Stigeoclonium helveticum
  • Insert Size (bp)
    1707
  • GenBank ID
    KF992040
  • Promoter CaMKII
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTGTGAGCAGCCACAGTG
  • 3′ sequencing primer GCAATAGCATGATACAAAGGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCK-Chronos-GFP was a gift from Edward Boyden (Addgene plasmid # 80902)
  • For your References section:

    Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633