Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TU#1806_CRISPR_unc-73_exon21
(Plasmid #82360)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82360 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDD162
  • Backbone manufacturer
    Bob Goldstein (Addgene plasmid # 47549)
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9 and sgRNA against unc-73 exon21
  • gRNA/shRNA sequence
    AATCTTCGCCAACTCCAGCAAGG
  • Species
    C. elegans (nematode)
  • Entrez Gene
    unc-73 (a.k.a. CELE_F55C7.7)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TU#1806_CRISPR_unc-73_exon21 was a gift from Martin Chalfie (Addgene plasmid # 82360 ; http://n2t.net/addgene:82360 ; RRID:Addgene_82360)
  • For your References section:

    GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Zheng C, Diaz-Cuadros M, Chalfie M. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6. 10.1073/pnas.1607179113 PubMed 27274054