Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #82677)


Item Catalog # Description Quantity Price (USD)
Plasmid 82677 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid# 48138)
  • Backbone size w/o insert (bp) 9300
  • Total vector size (bp) 9300
  • Modifications to backbone
    sgRNA cloned into the BbsI site of pX458
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA targeting mouse CD90.1
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-forward primer (ACTATCATATGCTTACCGTAAC)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid co-expresses Cas9 from S. pyogenes with 2A-EGFP, as part of the pX458 backbone. These plasmids were previously associated with the following preprint: Highly efficient and versatile plasmid-based gene editing in primary T cells bioRxiv. 13 January 2018. doi:10.1101/247544

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p163_LTJ_sgRNACD90.1 was a gift from Lukas Jeker (Addgene plasmid # 82677 ; ; RRID:Addgene_82677)
  • For your References section:

    Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. Kornete M, Marone R, Jeker LT. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121. 10.4049/jimmunol.1701121 PubMed 29445007