pGrDL_SPb
(Plasmid #83205)

• Purpose: receives miRNA target sequences for testing using the dual luciferase assay system
• Depositing Lab: Peer Schenk
• Publication: Moyle et al Front Plant Sci. 2017 Sep 20;8:1631. doi: 10.3389/fpls.2017.01631. eCollection 2017.

Backbone

• Vector backbone: pGrDL_SP
• Backbone manufacturer: Richard Moyle
• Backbone size w/o insert (bp): 7086
• Total vector size (bp): 7769
• Modifications to backbone: replaced NOS promoter with a tomato ACTIN promoter to drive expression of the Renilla luciferase
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tomato ACTIN promoter
• Species: Tomato
• Insert Size (bp): 1007
• Promoter: Tomato ACTIN

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FSPI (unknown if destroyed)
• 3′ cloning site: PSPXI (destroyed during cloning)
• 5′ sequencing primer: ccactgcggaccagttatcatcc
• 3′ sequencing primer: cgccagctggcgtaatagc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry