VanGlow-GL
(Plasmid
#83342)
-
Purpose(Empty Backbone) for Gateway cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBPGw
-
Backbone manufacturerRubin Lab
- Backbone size (bp) 11386
-
Modifications to backboneThe GAL4 sequence of pBPGw was replaced with a GFP::Luciferase(nls) reporter that is codon optimized for expression in Drosophila.
-
Vector typeInsect Expression, Luciferase
-
Selectable markersminiwhite
-
Tag
/ Fusion Protein
- GFP::Luciferase(nls) (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AAATAGGGGTTCCGCGCACAT
- 3′ sequencing primer GCAGATTGTTTAGCTTGTTCAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
VanGlow-GL-promoter is a Gateway compatible vector enabling high throughput cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter protein (codon optimized for expression in Drosophila) using Invitrogen LR clonase. This vector can be used for Luciferase assays in S2 cells and can be inserted into specific target sites in the Drosophila genome using PhiC31 integrase and used to assess reporter gene expression in vivo using Immunofluorescence, Live-Cell-Imaging, and Luciferase assays. In addition, this vector may be used in combination with other VanGlow transgenes to facilitate FACS purification of specific populations of cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VanGlow-GL was a gift from Cheng-Yu Lee (Addgene plasmid # 83342 ; http://n2t.net/addgene:83342 ; RRID:Addgene_83342) -
For your References section:
An Hdac1/Rpd3-Poised Circuit Balances Continual Self-Renewal and Rapid Restriction of Developmental Potential during Asymmetric Stem Cell Division. Janssens DH, Hamm DC, Anhezini L, Xiao Q, Siller KH, Siegrist SE, Harrison MM, Lee CY. Dev Cell. 2017 Feb 27;40(4):367-380.e7. doi: 10.1016/j.devcel.2017.01.014. 10.1016/j.devcel.2017.01.014 PubMed 28245922