pCDNA3_UnaG-Flag-Sec61B
(Plasmid #83413)

• Purpose: Expressed N-term tagged UnaG on Sec61B
• Depositing Lab: Hyun-Woo Rhee
• Publication: Park et al ACS Chem Biol. 2016 May 27.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5378
• Total vector size (bp): 6120
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UnaG-Sec61B
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 742
• GenBank ID: NM_006808.2. NM_006808.2.
• Entrez Gene: SEC61B

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: tagtaggaattcatgcctggtccgacccc
• 3′ sequencing primer: tagtagctcgagTCAcgaacgagtgtacttgcccca

Resource Information

• Supplemental Documents:
  • expected_JS49 UnaG-Sec61B_pCDNA3.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry