pPJ167(JPUB_006765)
(Plasmid
#83831)
-
PurposeCarries NEW operon 3 final
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBbE0k backbone (colE1 ori, kanR)
- Total vector size (bp) 712
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium copy strain
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste2803
-
Alt nameSAM radical enzyme
-
Insert Size (bp)1482
- Promoter op3_BsmBI_2803_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aattccgaattcatgagatctggatccgtctcaatgaagaaactggttctgatcaacc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste2804
-
Alt nameFabF
-
Insert Size (bp)1218
- Promoter op3_2804_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cataaaggaggttttctaatgaaaatgaccaaagttgtgattacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ167(JPUB_006765) was a gift from Harry Beller (Addgene plasmid # 83831 ; http://n2t.net/addgene:83831 ; RRID:Addgene_83831) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050