pPJ173(JPUB_006777)
(Plasmid
#83834)
-
PurposeCarries NEW operon 10 final
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBbE0k backbone (colE1 ori, kanR)
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste3336
-
Alt namePhyotene desaturase
-
Insert Size (bp)1455
- Promoter op10_BsaI_3336_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aattccgaattcatgagatctggatcggtctcaatgaaagattttgatgtgattgttatcgg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste3339
-
Alt nameFabZ
-
Insert Size (bp)441
- Promoter op10_3339_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer catttaaaggaggttttctaatgaaaaaagcctttccaagtcc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameKuste3341
-
Alt nameFabG
-
Insert Size (bp)720
- Promoter op10_3341_for
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer cattaaaggtaccacctaaaggaggttttctaatgctggttacgggtggtag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ173(JPUB_006777) was a gift from Harry Beller (Addgene plasmid # 83834 ; http://n2t.net/addgene:83834 ; RRID:Addgene_83834) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050