This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLdCH
(Plasmid #84291)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84291 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSP72
  • Total vector size (bp) 9358
  • Vector type
    CRISPR ; Leishmania
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and Cas9
  • gRNA/shRNA sequence
    new gRNA guide
  • Species
    Leishmania
  • Promoter L. donovani ribosome RNA promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs I (not destroyed)
  • 3′ cloning site Bbs I (not destroyed)
  • 5′ sequencing primer CATATGTGAGTTATGAGGTCTGCGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pX330-U6-Chimeric_BB- CBh-hSpCas9 Obtained from Brodt Institute (through Addgene)
  • Terms and Licenses

Depositor Comments

This Leishmania CRISPR vector co-express gRNA and Cas9 with Hygromycin resistance. It can also be used to express dual, triple or more gRNAs simultaneously with Cas9.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLdCH was a gift from Greg Matlashewski (Addgene plasmid # 84291 ; http://n2t.net/addgene:84291 ; RRID:Addgene_84291)
  • For your References section:

    Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. Zhang WW, Lypaczewski P, Matlashewski G. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. mSphere00340-16 [pii] PubMed 28124028