Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSF4 TET CMV intron renilla 24xPP7 24xMS2
(Plasmid #84444)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84444 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSF4
  • Vector type
    Mammalian Expression, Luciferase ; FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    renilla - 24xPP7+24xMS2
  • Species
    Synthetic
  • Insert Size (bp)
    3901
  • Promoter TET+CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer Cgagacagagaagactcttgc
  • 3′ sequencing primer ggttacaaataaggcaatagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSF4 TET CMV intron renilla 24xPP7 24xMS2 was a gift from Jeffrey Chao (Addgene plasmid # 84444 ; http://n2t.net/addgene:84444 ; RRID:Addgene_84444)
  • For your References section:

    Detection of the First Round of Translation: The TRICK Assay. Voigt F, Eglinger J, Chao JA. Methods Mol Biol. 2018;1649:373-384. doi: 10.1007/978-1-4939-7213-5_25. 10.1007/978-1-4939-7213-5_25 PubMed 29130211