-
PurposeLentiviral construct to express dCas9 fused with an inactive Dnmt3a catalytic domain (E664A, E756A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
Lentiviral Prep | 84478-LV | This item has been discontinued. | ||||
Concentrated Lentiviral Prep | 84478-LVC | This item has been discontinued. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUW
- Backbone size w/o insert (bp) 9207
- Total vector size (bp) 14313
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin ; Resistance marker is outside the LTRs and will not be packaged into virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-Dnmt3a_IM
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)5106
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer aactatgcgctcggg
- 3′ sequencing primer taaagcagcgtatcc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Information for Lentiviral Prep (Catalog # 84478-LV) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
This item has been discontinued.
Purpose
Ready-to-use Lentiviral Prep particles produced from Fuw-dCas9-Dnmt3a_IM (#84478). In addition to the viral particles, you will also receive purified Fuw-dCas9-Dnmt3a_IM plasmid DNA.
Lentiviral particles carrying dCas9 fused with an inactive Dnmt3a catalytic domain (E664A, E756A)Delivery
- Volume .
- Titer ≥5x10⁵ TU/mL
- Pricing $100 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84478-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
- PCR confirmation of insert: PCR was carried out with primers targeting the dCas9 protein and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
- Forward Primer: dCas9-fwd, ACCGTGTACAACGAGCTGAC
- Reverse Primer: WPRE-R, CATAGCGTAAAAGGAGCAACA
- Confirmation of protein expression: A549 cells were transduced with 84478-LV. 96 hours later, cells were fixed in 4% paraformaledyhyde and stained with 5 μg/mL anti-CRISPR Cas9 [7A9-3A3] (Abcam ab191468) primary antibody and Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (ThermoFisher R37114). Nuclei were counterstained with DAPI. Cas9 expression was confirmed by fluorescence microscopy.
Visit our viral production page for more information.
Information for Concentrated Lentiviral Prep (Catalog # 84478-LVC) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
This item has been discontinued.
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from Fuw-dCas9-Dnmt3a_IM (#84478). In addition to the viral particles, you will also receive purified Fuw-dCas9-Dnmt3a_IM plasmid DNA.
Lentiviral particles carrying dCas9 fused with an inactive Dnmt3a catalytic domain (E664A, E756A)Delivery
- Volume .
- Titer ≥5×10⁷ TU/mL
- Pricing $150 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84478-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
- Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fuw-dCas9-Dnmt3a_IM was a gift from Rudolf Jaenisch (Addgene plasmid # 84478 ; http://n2t.net/addgene:84478 ; RRID:Addgene_84478)
For viral preps, please replace (Addgene plasmid # 84478) in the above sentence with: (Addgene viral prep # 84478-LV) or (Addgene viral prep # 84478-LVC)
-
For your References section:
Editing DNA Methylation in the Mammalian Genome. Liu XS, Wu H, Ji X, Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R. Cell. 2016 Sep 22;167(1):233-247.e17. doi: 10.1016/j.cell.2016.08.056. 10.1016/j.cell.2016.08.056 PubMed 27662091