-
PurposeLentiviral construct to express dCas9 fused with an inactive catalytic domain of Tet1 (H1672Y, D1674A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 | ||
Lentiviral Prep | 84479-LV | Virus (1 mL at titer ≥ 5x10⁵ TU/mL) | ||||
Concentrated Lentiviral Prep | 84479-LVC | Virus (50 µL at titer ≥ 5×10⁷ TU/mL) |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUW
- Backbone size w/o insert (bp) 9213
- Total vector size (bp) 15573
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin ; Resistance marker is outside the LTRs and will not be packaged into virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-Tet1CD_IM
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)6351
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer aactatgcgctcggg
- 3′ sequencing primer taaagcagcgtatcc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Articles Citing this Plasmid
Information for Lentiviral Prep (Catalog # 84479-LV) ( Back to top )
Purpose
Ready-to-use Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD_IM (#84479). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD_IM plasmid DNA.
Lentiviral particles carrying dCas9 fused with an inactive catalytic domain of Tet1 (H1672Y, D1674A)Delivery
- Volume 1 mL
- Titer ≥5x10⁵ TU/mL
- Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84479-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
- PCR confirmation of insert: PCR was carried out with primers targeting the Tet1CD protein. The PCR product was sequenced using the Sanger method to confirm the sequence.
- Forward Primer: Tet1CD variant FP1, GCACCCTCAATGAAAATCGT
- Reverse Primer: Tet1CD variant RP1, TTGATCTTGGCTTCCATTCC
- Sequencing Forward Primer: Tet1CD variant SP1, TGGCTACACGATTAGCTCCA
- Sequencing Reverse Primer: Tet1CD variant SP2, CATGGAGCTGCTCATCTTGA
- Confirmation of protein expression: A549 cells were transduced with 84479-LV. 96 hours later, cells were fixed in 4% paraformaledyhyde and stained with 5 μg/mL anti-CRISPR Cas9 [7A9-3A3] (Abcam ab191468) primary antibody and Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (ThermoFisher R37114). Nuclei were counterstained with DAPI. Cas9 expression was confirmed by fluorescence microscopy.
Visit our viral production page for more information.
Information for Concentrated Lentiviral Prep (Catalog # 84479-LVC) ( Back to top )
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD_IM (#84479). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD_IM plasmid DNA.
Lentiviral particles carrying dCas9 fused with an inactive catalytic domain of Tet1 (H1672Y, D1674A)Delivery
- Volume 50 µL
- Titer ≥5×10⁷ TU/mL
- Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84479-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
- Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fuw-dCas9-Tet1CD_IM was a gift from Rudolf Jaenisch (Addgene plasmid # 84479 ; http://n2t.net/addgene:84479 ; RRID:Addgene_84479)
For viral preps, please replace (Addgene plasmid # 84479) in the above sentence with: (Addgene viral prep # 84479-LV) or (Addgene viral prep # 84479-LVC)
-
For your References section:
Editing DNA Methylation in the Mammalian Genome. Liu XS, Wu H, Ji X, Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R. Cell. 2016 Sep 22;167(1):233-247.e17. doi: 10.1016/j.cell.2016.08.056. 10.1016/j.cell.2016.08.056 PubMed 27662091