This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV CAG ChR2 E123T T159C 2A tDimer
(Plasmid #85399)


Item Catalog # Description Quantity Price (USD)
Plasmid 85399 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5802
  • Total vector size (bp) 8244
  • Modifications to backbone
    Inserted CAG promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Mutation
    E123T , T159C
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tttcgccacctctgactt
  • 3′ sequencing primer CAGCCGCAGGTTGACTTCCATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
  • Species
    Discosoma sp.
  • Insert Size (bp)
  • Promoter ribosomal skip sequence 2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CAG Promoter was taken from Addgene #11160 ChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

Layer-specific optogenetic activation of pyramidal neurons causes beta-gamma entrainment of neonatal networks.

Nat Commun. 2017 Feb 20;8:14563. doi: 10.1038/ncomms14563.

Bitzenhofer SH1, Ahlbeck J1, Wolff A1, Wiegert JS2, Gee CE2, Oertner TG2, Hanganu-Opatz IL1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CAG ChR2 E123T T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85399 ; ; RRID:Addgene_85399)
  • For your References section:

    High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Berndt A, Schoenenberger P, Mattis J, Tye KM, Deisseroth K, Hegemann P, Oertner TG. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19. 10.1073/pnas.1017210108 PubMed 21504945