Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAGM4723:TpCC_Urease
(Plasmid #85982)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85982 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAGM4723
  • Backbone manufacturer
    Sylvestre Marillonnet (Addgene #48015)
  • Vector type
    CRISPR ; Diatom (T. pseudonana)
  • Selectable markers
    Nourseothricin (Nat)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyogenes
  • Promoter FCP
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • YFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
  • 3′ sequencing primer EXFP-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Urease-targeting gRNA 1
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer RB-F1 (ggataaaccttttcacgccc)
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Urease-targeting gRNA 2
  • Promoter U6

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer RB-F1 (ggataaaccttttcacgccc)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The cassette from pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. The sgRNA scaffold was PCR amplified from Addgene #46966.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGM4723:TpCC_Urease was a gift from Thomas Mock (Addgene plasmid # 85982 ; http://n2t.net/addgene:85982 ; RRID:Addgene_85982)
  • For your References section:

    Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Hopes A, Nekrasov V, Kamoun S, Mock T. Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016. 10.1186/s13007-016-0148-0 PubMed 27904648