Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAc5 HA3-eDHFR-T2A-puro
(Plasmid #86395)


Item Catalog # Description Quantity Price (USD)
Plasmid 86395 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    HA3 eDHFR T2A puro
  • Species
    E coli
  • Mutation
    R12Y, G67S and Y100I mutations in E coli DHFR
  • Tag / Fusion Protein
    • HA3 eDHFR T2A puro

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggaggcggttacccatac
  • 3′ sequencing primer gtcgactgatcataatcagc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The mutant E coli DHFR gene used in the two plasmids was derived from Cho et al PlosOne 8: e72393 Addgene plasmid 29325.
  • Terms and Licenses

Depositor Comments

pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 (Bassett, A.R.,et al Biol Open 3:42, 2014) by replacing the EcoRI-Hind III fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP (Iwamoto eet al Chem Biol 17:981, 2010.) (Addgene plasmid #29325)
This degron has R12Y, G67S and Y100I mutations in eDHFR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc5 HA3-eDHFR-T2A-puro was a gift from David Bentley (Addgene plasmid # 86395 ; ; RRID:Addgene_86395)
  • For your References section:

    Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins. Sheridan RM, Bentley DL. Biotechniques. 2016 Feb 1;60(2):69-74. doi: 10.2144/000114378. eCollection 2016 Feb. 10.2144/000114378 PubMed 26842351