This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCV-ArchT-GFP
(Plasmid #86536)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86536 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV
  • Backbone size w/o insert (bp) 6910
  • Total vector size (bp) 7657
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArchT
  • Alt name
    archaerhodopsin TP009
  • Species
    Synthetic; H. strain TP009
  • Insert Size (bp)
    747
  • GenBank ID
    HM367071.1
  • Promoter Synapsin I (human)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGTGGCTGGGAATCGGAACC
  • 3′ sequencing primer AACCAGTGGGGGTTGCGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-ArchT-GFP was a gift from Xue Han (Addgene plasmid # 86536)
  • For your References section:

    Young adult born neurons enhance hippocampal dependent performance via influences on bilateral networks. Zhuo JM, Tseng HA, Desai M, Bucklin ME, Mohammed AI, Robinson NT, Boyden ES, Rangel LM, Jasanoff AP, Gritton HJ, Han X. Elife. 2016 Dec 3;5. pii: e22429. doi: 10.7554/eLife.22429. 10.7554/eLife.22429 PubMed 27914197