Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ChR2-2A-Halo
(Plasmid #22047)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22047 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 3963
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChR2-GFP-2A-Halo-YFP
  • Alt name
    NpHR
  • Alt name
    channelrhodopsin
  • Alt name
    halorhodopsin
  • Species
    C. reinhardtii, N. pharaonis
  • Insert Size (bp)
    3356
  • Mutation
    Note that there is a S147R mut in YFP. This mutation is not known to affect fluorescence.
  • Tag / Fusion Protein
    • GFP and YFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AGCAGAGCTGGTTTAGTGAA
  • 3′ sequencing primer TAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER NOVEL REAGENTS IN THIS LINE.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ChR2-2A-Halo was a gift from Edward Boyden (Addgene plasmid # 22047)
  • For your References section:

    Informational lesions: optical perturbation of spike timing and neural synchrony via microbial opsin gene fusions. Han X, Qian X, Stern P, Chuong AS, Boyden ES. Front Mol Neurosci. 2009 . 2():12. 10.3389/neuro.02.012.2009 PubMed 19753326