Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22047)


Item Catalog # Description Quantity Price (USD)
Plasmid 22047 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3963
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
  • Species
    C. reinhardtii, N. pharaonis
  • Insert Size (bp)
  • Mutation
    Note that there is a S147R mut in YFP. This mutation is not known to affect fluorescence.
  • Tag / Fusion Protein
    • GFP and YFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AGCAGAGCTGGTTTAGTGAA
  • 3′ sequencing primer TAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ChR2-2A-Halo was a gift from Edward Boyden (Addgene plasmid # 22047 ; ; RRID:Addgene_22047)
  • For your References section:

    Informational lesions: optical perturbation of spike timing and neural synchrony via microbial opsin gene fusions. Han X, Qian X, Stern P, Chuong AS, Boyden ES. Front Mol Neurosci. 2009 . 2():12. 10.3389/neuro.02.012.2009 PubMed 19753326