Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #14750)


Item Catalog # Description Quantity Price (USD)
Plasmid 14750 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9500
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
  • Copy number


  • Gene/Insert name
    Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
  • Alt name
  • Alt name
  • Alt name
  • Species
    N. pharaonis
  • Insert Size (bp)
  • Mutation
    N. pharaonis halorhodopsin is mammalian codon-optimized
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgactgagaccctcccacccgtgactgaaagcgccgt
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCK-Halo-GFP was a gift from Edward Boyden (Addgene plasmid # 14750)
  • For your References section:

    Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Han X, Boyden ES. PLoS ONE. 2007 . 2():e299. 10.1371/journal.pone.0000299 PubMed 17375185