1
Plasmid 14750: FCK-Halo-GFP
  • Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus

  • Halo

  • Halo-GFP

  • NpHR

  • 1300

  • N. pharaonis

  • GFP

  • C terminal on insert

  • N. pharaonis halorhodopsin is mammalian codon-optimized

  • FCK(1.3)GW
    (Search Vector Database)

  • Pavel Osten

  • Mammalian Expression, Lentiviral

  • 9500

  • AgeI

  • No

  • EcoRI

  • No

  • atgactgagaccctcccacccgtgactgaaagcgccgt List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)

  • Unknown

  • We purchased the gene to be synthesized by Epoch Biolabs (Sugar Land, TX)

  • View sequences (3)
  • View map

  • Edward Boyden

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS
REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Han et al (PLoS ONE. 2007 . 2():e299. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14750" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only