pCAGGS-ChR2-Venus
(Plasmid #15753)

• Purpose: Expresses ChR2-Venus for neuronal excitation.
• Depositing Lab: Karel Svoboda
• Publication: Petreanu et al Nat Neurosci. 2007 May . 10(5):663-8.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 5864
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Channelrhodopsin2-Venus
• Alt name: ChR2-Venus
• Alt name: Channelrhodopsin-2
• Insert Size (bp): 1676
• Promoter: CAG
• Tag / Fusion Protein:
  • Venus (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: ctcctgggcaacgtgctggttg

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• A portion of this plasmid was derived from a plasmid made by: G Nagel, Max-Planck-Institut fur Biophysik, Frankfurt, Germany.
• Articles Citing this Plasmid:
  • 19 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry