pCAGGS-ChR2-Venus
(Plasmid #15753)

• Depositing Lab: Karel Svoboda
• Publication: Petreanu et al Nat Neurosci. 2007 May . 10(5):663-8.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	15753	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pCAGGS
  (Search Vector Database)
• Backbone size w/o insert (bp): 5864
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Channelrhodopsin2-Venus
• Alt name: ChR2-Venus
• Alt name: Channelrhodopsin-2
• Insert Size (bp): 1676
• Tag / Fusion Protein:
  • Venus (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: ctcctgggcaacgtgctggttg

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• A portion of this plasmid was derived from a plasmid made by: G Nagel, Max-Planck-Institut fur Biophysik, Frankfurt, Germany.
• Terms and Licenses:
  • UBMTA
• Articles Citing this Plasmid:
  • 17 References