ATP1A1_plasmid_donor_RD
(Plasmid #86551)

• Purpose: Homology-directed repair (HDR) donor plasmid with homology arms to ATP1A1 to introduce the Q118R and N129D (RD) mutations conferring cellular resistance to ouabain
• Depositing Lab: Yannick Doyon
• Publication: Agudelo et al Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.

Backbone

• Vector backbone: pUC19
• Total vector size (bp): 3217
• Vector type: Mammalian Expression, CRISPR, TALEN ; Co-selection via HDR using ouabain
• Selectable markers: Ouabain

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1
• Alt name: ATPase Na+/K+ transporting subunit alpha 1
• Alt name: Gene ID: 476
• Species: H. sapiens (human)
• Mutation: Q118R, N129D
• GenBank ID: 476
• Entrez Gene: ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Acc65I (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cagggttattgtctcatgagcgg
• 3′ sequencing primer: tgagcgaggaagcggaagag

Resource Information

• Supplemental Documents:
  • ATP1A1_plasmid_donor_RD (2).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry