1
Plasmid 38119: pEGFP-N1-TFEB
  • TFEB

  • Transcription factor EB

  • 1428

  • H. sapiens (human)

  • NM_007162.2

  • TFEB (RP4-696P19.3, ALPHATFEB, BHLHE35, TCFEB)

  • EGFP

  • C terminal on insert

  • deleted stop codon

  • pEGFP-N1
    (Search Vector Database)

  • Glontech

  • Mammalian Expression

  • 4733

  • CMV

  • HindIII

  • No

  • KpnI

  • No

  • CGCAAATGGGCGGTAGGCGTG List of Sequencing Primers

  • CGTCGCCGTCCAGCTCGACCAG

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • Neomycin

  • Andrea Ballabio, TIGEM, Naples, Italy

  • View sequences (2)
  • Shawn Ferguson

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Roczniak-Ferguson et al (Sci Signal. 2012 Jun 12;5(228):ra42. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 38119" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only