-
PurposeReporter for activity of TFEB gene promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTFEB promoter
-
Alt nameTcfeb
-
Alt namebHLHe35
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
Entrez GeneTfeb (a.k.a. Tcfeb, bHLHe35)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhei (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
- 3′ sequencing primer EBV rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To derive the TFEB promoter-report construct, we PCR-amplified a 2-kb proximal promoter fragment from mouse BAC RP23-205M10 DNA (BACPAC Resources Center) and inserted this fragment into the Nhe I and Hind III restriction sites in the pGL3-Basic vector (Promega).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TFEB promoter-luciferase reporter was a gift from Albert La Spada (Addgene plasmid # 66801 ; http://n2t.net/addgene:66801 ; RRID:Addgene_66801) -
For your References section:
PGC-1alpha rescues Huntington's disease proteotoxicity by preventing oxidative stress and promoting TFEB function. Tsunemi T, Ashe TD, Morrison BE, Soriano KR, Au J, Roque RA, Lazarowski ER, Damian VA, Masliah E, La Spada AR. Sci Transl Med. 2012 Jul 11;4(142):142ra97. doi: 10.1126/scitranslmed.3003799. 10.1126/scitranslmed.3003799 PubMed 22786682