TFEB promoter-luciferase reporter
(Plasmid #66801)

• Purpose: Reporter for activity of TFEB gene promoter
• Depositing Lab: Albert La Spada
• Publication: Tsunemi et al Sci Transl Med. 2012 Jul 11;4(142):142ra97. doi: 10.1126/scitranslmed.3003799.

Backbone

• Vector backbone: pGL3-Basic
• Backbone manufacturer: Promega
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TFEB promoter
• Alt name: Tcfeb
• Alt name: bHLHe35
• Species: M. musculus (mouse)
• Insert Size (bp): 2000
• Entrez Gene: Tfeb (a.k.a. Tcfeb, bHLHe35)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhei (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC)
• 3′ sequencing primer: EBV rev

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To derive the TFEB promoter-report construct, we PCR-amplified a 2-kb proximal promoter fragment from mouse BAC RP23-205M10 DNA (BACPAC Resources Center) and inserted this fragment into the Nhe I and Hind III restriction sites in the pGL3-Basic vector (Promega).