Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TFEB promoter-luciferase reporter
(Plasmid #66801)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66801 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TFEB promoter
  • Alt name
    Tcfeb
  • Alt name
    bHLHe35
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2000
  • Entrez Gene
    Tfeb (a.k.a. Tcfeb, bHLHe35)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhei (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
  • 3′ sequencing primer EBV rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

To derive the TFEB promoter-report construct, we PCR-amplified a 2-kb proximal promoter fragment from mouse BAC RP23-205M10 DNA (BACPAC Resources Center) and inserted this fragment into the Nhe I and Hind III restriction sites in the pGL3-Basic vector (Promega).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TFEB promoter-luciferase reporter was a gift from Albert La Spada (Addgene plasmid # 66801 ; http://n2t.net/addgene:66801 ; RRID:Addgene_66801)
  • For your References section:

    PGC-1alpha rescues Huntington's disease proteotoxicity by preventing oxidative stress and promoting TFEB function. Tsunemi T, Ashe TD, Morrison BE, Soriano KR, Au J, Roque RA, Lazarowski ER, Damian VA, Masliah E, La Spada AR. Sci Transl Med. 2012 Jul 11;4(142):142ra97. doi: 10.1126/scitranslmed.3003799. 10.1126/scitranslmed.3003799 PubMed 22786682