-
PurposeFor ubiquitous expression of Cas9 in planta. sgRNA can be introduced as described in Hahn et al. (2017)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKB65
-
Backbone manufacturerKristin Bernhardt
- Backbone size w/o insert (bp) 11630
- Total vector size (bp) 14121
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesSynthetic
-
Insert Size (bp)4137
-
MutationCas9 is codon optimized for C. reinhardtii
- Promoter UBIQUITIN10
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTTCGTTCGATCCCAATTTC
- 3′ sequencing primer aagaccggcaacaggattc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPeter Hegemann, HU Berlin
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See Hahn et al., 2017
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUB-Cas9 was a gift from Andreas Weber (Addgene plasmid # 86556 ; http://n2t.net/addgene:86556 ; RRID:Addgene_86556) -
For your References section:
An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. 10.3389/fpls.2017.00039 PubMed 28174584