Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV9:cTNT::3Flag-hYAP S127A
(Plasmid #86558)


Item Catalog # Description Quantity Price (USD)
Plasmid 86558 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Upen vector core
  • Modifications to backbone
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Yes associated protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Serine 127 was mutated into Alanine, to activate YAP.
  • GenBank ID
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP2, YAP65, YKI)
  • Promoter cTNT
  • Tag / Fusion Protein
    • 3Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
  • 3′ sequencing primer CCAGAAGTCAGATGCTCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The YAP gene CDS was originally from Fernando Camargo lab, Boston Children's Hospital
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV9:cTNT::3Flag-hYAP S127A was a gift from William Pu (Addgene plasmid # 86558 ; ; RRID:Addgene_86558)
  • For your References section:

    Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Lin Z, von Gise A, Zhou P, Gu F, Ma Q, Jiang J, Yau AL, Buck JN, Gouin KA, van Gorp PR, Zhou B, Chen J, Seidman JG, Wang DZ, Pu WT. Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15. 10.1161/CIRCRESAHA.115.303632 PubMed 24833660