-
PurposeTo produce cardiac specific adeno-associated virus expressing activated human YAP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV.cTNT.
-
Backbone manufacturerUpen vector core
-
Modifications to backboneNone
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYAP
-
Alt nameYes associated protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1548
-
MutationSerine 127 was mutated into Alanine, to activate YAP.
-
GenBank IDNP_001181973.1 NM_001130145.2
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter cTNT
-
Tag
/ Fusion Protein
- 3Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
- 3′ sequencing primer CCAGAAGTCAGATGCTCAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe YAP gene CDS was originally from Fernando Camargo lab, Boston Children's Hospital
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV9:cTNT::3Flag-hYAP S127A was a gift from William Pu (Addgene plasmid # 86558 ; http://n2t.net/addgene:86558 ; RRID:Addgene_86558) -
For your References section:
Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Lin Z, von Gise A, Zhou P, Gu F, Ma Q, Jiang J, Yau AL, Buck JN, Gouin KA, van Gorp PR, Zhou B, Chen J, Seidman JG, Wang DZ, Pu WT. Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15. 10.1161/CIRCRESAHA.115.303632 PubMed 24833660