Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86641)


Item Catalog # Description Quantity Price (USD)
Plasmid 86641 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Carlos Lois
  • Backbone size w/o insert (bp) 7944
  • Total vector size (bp) 9434
  • Modifications to backbone
    replaced the CMV promoter with hSynapsin promoter
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter hSynapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcagcggaggagtcgtgtcg
  • 3′ sequencing primer ccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hSynapsin-Cre-WPRE was a gift from Fan Wang (Addgene plasmid # 86641 ; ; RRID:Addgene_86641)
  • For your References section:

    Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160