-
PurposeExpresses Cre in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 86641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiviral
-
Backbone manufacturerCarlos Lois
- Backbone size w/o insert (bp) 7944
- Total vector size (bp) 9434
-
Modifications to backbonereplaced the CMV promoter with hSynapsin promoter
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, Synthetic Biology
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre
-
SpeciesSynthetic
-
Insert Size (bp)981
- Promoter hSynapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gcagcggaggagtcgtgtcg
- 3′ sequencing primer ccacatagcgtaaaaggagc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hSynapsin-Cre-WPRE was a gift from Fan Wang (Addgene plasmid # 86641 ; http://n2t.net/addgene:86641 ; RRID:Addgene_86641) -
For your References section:
Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160