Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86695)


Item Catalog # Description Quantity Price (USD)
Plasmid 86695 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    AAVS1 SA-2A-puro-pA donor Addgene 22075
  • Backbone manufacturer
    Rudolf Jaenisch
  • Backbone size (bp) 9487
  • Modifications to backbone
    BglII site removed, H1 TO sequence added in HincII site, CAG-OPTtetR-pA added in at pspXI blunt ended site.
  • Vector type
    Mammalian Expression
  • Promoter H1 TO
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGAACGCTGACGTCATCAACC
  • 3′ sequencing primer GGGCTATGAACTAATGACCCCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    H1-TO promoter taken from pSuperior Neo (oligoengine)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Puro_siKD was a gift from Ludovic Vallier (Addgene plasmid # 86695 ; ; RRID:Addgene_86695)
  • For your References section:

    Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Bertero A, Pawlowski M, Ortmann D, Snijders K, Yiangou L, Cardoso de Brito M, Brown S, Bernard WG, Cooper JD, Giacomelli E, Gambardella L, Hannan NR, Iyer D, Sampaziotis F, Serrano F, Zonneveld MC, Sinha S, Kotter M, Vallier L. Development. 2016 Dec 1;143(23):4405-4418. 10.1242/dev.138081 PubMed 27899508