Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p426_Cas9_gRNA-ARS1206a
(Plasmid #87398)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p426
  • Vector type
    CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
  • gRNA/shRNA sequence
    CGAACATTTTTCCATGCGCT
  • Species
    S. cerevisiae (budding yeast)
  • Promoter ADH1, pTyrosine

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426_Cas9_gRNA-ARS1206a was a gift from Aindrila Mukhopadhyay (Addgene plasmid # 87398 ; http://n2t.net/addgene:87398 ; RRID:Addgene_87398)
  • For your References section:

    A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Reider Apel A, d'Espaux L, Wehrs M, Sachs D, Li RA, Tong GJ, Garber M, Nnadi O, Zhuang W, Hillson NJ, Keasling JD, Mukhopadhyay A. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. 10.1093/nar/gkw1023 PubMed 27899650