p426_Cas9_gRNA-ARS1414a
(Plasmid
#87400)
-
PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep426
-
Vector typeCRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
-
gRNA/shRNA sequenceGCGCCACAGTTTCAAGGGTC
-
SpeciesS. cerevisiae (budding yeast)
- Promoter ADH1, pTyrosine
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426_Cas9_gRNA-ARS1414a was a gift from Aindrila Mukhopadhyay (Addgene plasmid # 87400 ; http://n2t.net/addgene:87400 ; RRID:Addgene_87400) -
For your References section:
A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Reider Apel A, d'Espaux L, Wehrs M, Sachs D, Li RA, Tong GJ, Garber M, Nnadi O, Zhuang W, Hillson NJ, Keasling JD, Mukhopadhyay A. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. 10.1093/nar/gkw1023 PubMed 27899650