Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87682)


Item Catalog # Description Quantity Price (USD)
Plasmid 87682 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 5969
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Check for recombination between ITRs and U6 promoters before making AAV
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CGGCCGCACGCGCCGGTACC
  • 3′ sequencing primer CAGAAGAGCTCGCTCTTCCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site none (destroyed during cloning)
  • 5′ sequencing primer GTGGAATTCCACCTGCTCAG
  • 3′ sequencing primer AGGGACTTCGGGCACAATCG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter cTnT

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ACGACTCACTATAGGCTAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-U6gRNA1-U6gRNA2-TnT-Cre was a gift from William Pu (Addgene plasmid # 87682 ; ; RRID:Addgene_87682)
  • For your References section:

    Analysis of Cardiac Myocyte Maturation Using CASAAV, A Platform for Rapid Dissection of Cardiac Myocyte Gene Function In Vivo. Guo Y, VanDusen NJ, Zhang L, Gu W, Sethi I, Guatimosim S, Ma Q, Jardin BD, Ai Y, Zhang D, Chen B, Guo A, Yuan GC, Song LS, Pu WT. Circ Res. 2017 Mar 29. pii: CIRCRESAHA.116.310283. doi: 10.1161/CIRCRESAHA.116.310283. 10.1161/CIRCRESAHA.116.310283 PubMed 28356340