pAAV-EF1a-FLuc-WPRE-HGHpA
(Plasmid
#87951)
-
PurposeRecombinant single-stranded AAV transfer vector expressing Firefly Luciferase under the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV with AAV2 ITRs
- Total vector size (bp) 6983
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNeed to check ITR presence and orientation every time you amplify to ensure the ITRs haven't recombined. Perform a restriction digest with XmaI (only cuts in the ITRs, should produce two bands of approximate sizes 2.7kb and 4.2kb)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameFLuc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1653
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI, NcoI, MreI (unknown if destroyed)
- 3′ cloning site EcoRI, EcoRV (unknown if destroyed)
- 5′ sequencing primer GGGTTTTATGCGATGGAGTTTC
- 3′ sequencing primer AGGTGCCTAAAGGACTGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-FLuc-WPRE-HGHpA was a gift from Mark Kay (Addgene plasmid # 87951 ; http://n2t.net/addgene:87951 ; RRID:Addgene_87951) -
For your References section:
Bioengineered AAV Capsids with Combined High Human Liver Transduction In Vivo and Unique Humoral Seroreactivity. Paulk NK, Pekrun K, Zhu E, Nygaard S, Li B, Xu J, Chu K, Leborgne C, Dane AP, Haft A, Zhang Y, Zhang F, Morton C, Valentine MB, Davidoff AM, Nathwani AC, Mingozzi F, Grompe M, Alexander IE, Lisowski L, Kay MA. Mol Ther. 2017 Sep 25. pii: S1525-0016(17)30437-9. doi: 10.1016/j.ymthe.2017.09.021. 10.1016/j.ymthe.2017.09.021 PubMed 29055620