Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #88844)


Item Catalog # Description Quantity Price (USD)
Plasmid 88844 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3099
  • Total vector size (bp) 4757
  • Modifications to backbone
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Proteomonas sulcata
  • Insert Size (bp)
  • GenBank ID
    KX879679 KX879679
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGAACTATGCGCTCGGGGTTGGCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-ZipACR-EYFP was a gift from John Spudich (Addgene plasmid # 88844 ; ; RRID:Addgene_88844)
  • For your References section:

    The Expanding Family of Natural Anion Channelrhodopsins Reveals Large Variations in Kinetics, Conductance, and Spectral Sensitivity. Govorunova EG, Sineshchekov OA, Rodarte EM, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. Sci Rep. 2017 Mar 3;7:43358. doi: 10.1038/srep43358. 10.1038/srep43358 PubMed 28256618