PGC-1 alpha promoter luciferase delta MEF
(Plasmid #8889)

• Depositing Lab: Bruce Spiegelman
• Publication: Handschin et al Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6.

Backbone

• Vector backbone: pGL3-basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PGC-1 alpha promoter dMEF
• Alt name: PGC1 promoter
• Alt name: PGC-1a promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 2600
• Mutation: Site-directed mutagenesis to remove the MEF2 binding site.
• Entrez Gene: Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC)
• 3′ sequencing primer: GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the MEF site between -1464 and -1447 from CTAAATATAA to CTCCGCGGAA.