1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
(Plasmid
#89061)
-
PurposeAAV-gRNA targeting the murine Ldlr gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 2508
- Total vector size (bp) 4596
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsConfirm ITR's remain intact with XmaI, SnaBI, PvuII digests
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEmGFP
-
gRNA/shRNA sequenceTGCTGCTGGCCAAGGACATG
-
SpeciesAequorea Victoria
- Promoter Chicken beta actin with partial CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP was a gift from William Lagor (Addgene plasmid # 89061 ; http://n2t.net/addgene:89061 ; RRID:Addgene_89061) -
For your References section:
Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Jarrett KE, Lee CM, Yeh YH, Hsu RH, Gupta R, Zhang M, Rodriguez PJ, Lee CS, Gillard BK, Bissig KD, Pownall HJ, Martin JF, Bao G, Lagor WR. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624. 10.1038/srep44624 PubMed 28300165