DNA-CARzeta-GFP
(Plasmid #89344)

• Purpose: 2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFP
• Depositing Lab: Ron Vale
• Publication: Taylor et al Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006.

Backbone

• Vector backbone: pHR
• Backbone size w/o insert (bp): 8311
• Total vector size (bp): 10767
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DNA-CARzeta
• Alt name: Signal-Peptide-SNAPf tag- TM-CD3zeta chains fused in frame to mGFP
• Species: H. sapiens (human)
• Insert Size (bp): 1803
• Entrez Gene: CD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
• Entrez Gene: CD86 (a.k.a. B7-2, B7.2, B70, CD28LG2, LAB72)
• Tags / Fusion Proteins:
  • SNAPf tag (N terminal on insert)
  • mEGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Mlu1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
• 3′ sequencing primer: GFP rev, WPRE rev (CCAGAGGTTGATTATCGATAAGC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry