DNA-CARzeta-IRESpuro
(Plasmid
#89345)
-
Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor upstream of a IRES-puro cassette
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8300
- Total vector size (bp) 11282
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA-CARzeta
-
Alt nameSignal-Peptide-SNAPf tag- TM-CD3zeta chains upstream of IRESpuromycin resistance cassette
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1803
-
Tag
/ Fusion Protein
- SNAPf tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
- 3′ sequencing primer WPRE rev (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DNA-CARzeta-IRESpuro was a gift from Ron Vale (Addgene plasmid # 89345 ; http://n2t.net/addgene:89345 ; RRID:Addgene_89345) -
For your References section:
A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336